AJTMH ASTMH MEMBERSHIP INFORMATION: astmh@astmh.org
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am. J. Trop. Med. Hyg., 74(4), 2006, pp. 526-531
Copyright © 2006 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by HOUHAMDI, L.
Right arrow Articles by RAOULT, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by HOUHAMDI, L.
Right arrow Articles by RAOULT, D.

EXPERIMENTAL INFECTION OF HUMAN BODY LICE WITH ACINETOBACTER BAUMANNII

LINDA HOUHAMDI AND DIDIER RAOULT*
Unité des Rickettsies, Institut Fédératif de Recherche 48, Centre National de Recherche Scientifique, Unité Mixte de Recherche 6020, Faculté de Médecine, Université de la Méditerranée, Marseille, France


ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The human body louse is currently recognized as a vector of Rickettsia prowazekii, Borrelia recurrentis, and Bartonella quintana. Previous studies have reported the isolation of Acinetobacter baumannii from the body lice of homeless patients. To study how the body louse acquires A. baumannii, we infected a rabbit by infusing 2 x 106 colony-forming units of the louse strain of A. baumannii. Two hundred body lice were infected by feeding on the bacteremic rabbit and compared with 200 uninfected lice and two groups of 200 lice feeding on rabbits infected either with another strain of A. baumannii or A. lwoffii. Each louse group received maintenance feedings once a day on another seronegative rabbit. Body lice that fed on rabbits infused with each Acinetobacter species demonstrated a generalized infection. The body lice did not transmit their infection to the nurse rabbit by bite while feeding or to their progeny (eggs and larvae). The lice excreted living Acinetobacter species within their feces. Only the louse strain of A. baumannii was pathogenic for the body louse. An increased mortality rate was observed between the second and third days post-infection; however, they remained infected for their lifespan.


INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Among the 3,000 louse species described, three are strictly human ectoparasites, and only the human body or clothing louse, Pediculus humanus corporis (Linne, 1758), is known to transmit human diseases. In nature, body lice transmit three pathogenic bacteria: Rickettsia prowazekii (the agent of epidemic typhus), Borrelia recurrentis (the agent of louse-borne relapsing fever), and Bartonella quintana (the agent of trench fever, bacillary angiomatosis, chronic bacteremia, endocarditis, and chronic lymphadenopathy).1 Our laboratory has previously reported the isolation of other human pathogens (Acinetobacter spp.,2 subsequently identified as A. baumannii,3 and Serratia marcescens2) from body lice collected from homeless people.

Acinetobacter spp. are widespread in nature (water, soil, mud, living organisms,4 vegetables,5 and the skin of patients or healthy subjects6). Although many species of Acinetobacter can cause infection, A. baumannii is the most frequently encountered species in the clinical laboratory,4 most notably in intensive care units.7,8 It has been linked to many severe hospital-acquired infections,7,9 including those of skin,10 wounds,7,11 the urinary tract,4,11 pneumonia,4,7,11–13 and meningitis.4,12,14 It exhibits a high level of resistance to antimicrobial agents and is capable of persisting in hostile environments (humidity or dryness and in the presence of some antiseptics).8 The presence of A. baumannii in human body lice2,3 is likely a naturally occurring global phenomena, as suggested by its detection in 21% of body lice3 collected worldwide.15 Although the louse ingests only blood from humans, its midgut is sterile and the presence of A. baumannii is due mainly to ingestion of infective blood meals from patients with ongoing bacteremia,2 or likely during the passage through the human skin while feeding.6

Our objective was to evaluate the relationship between the human body louse and A. baumannii. For this purpose, we used our experimental model of louse infection, which reproduces the natural infection, as demonstrated previously with B. quintana16 and R. prowazekii.17


MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Acinetobacter species. Three species of Acinetobacter were used in our study: a strain of A. baumannii from the Unité des Rickettsies (UR 10.72) isolated from a louse collected from a homeless patient,2 a strain of A. baumannii obtained from the Collection de l’Institut Pasteur (CIP 53.79) isolated from a whitlow in 1951, and strain of A. lwoffii (ATCC 15309 = CIP 64.10T). For each species, 100 µL of 10-fold serial dilutions (from undiluted to 10–12) in phosphate-buffered saline (PBS) (bioMérieux, Marcy l’Etoile, France) were streaked onto Columbia sheep blood agar (bioMérieux) and incubated at 37°C. The number of colony-forming units (CFU)/mL in each dilution was determined on the third day following inoculation.

Infection of human body louse with Acinetobacter spp. Each of three specific pathogen–free (SPF) New Zealand white female rabbits (weighing 6 kg and containing between 360 and 420 mL of blood) was infected by a 15-minute auricular intravenous infusion of 20 mL of PBS containing 105 CFU/mL of one of the three species of Acinetobacter to obtain a persistent artificial bacteremia. Thus, the number of bacteria given to the rabbit host was between 4.5 and 5.26 x 103 CFU/mL of rabbit blood. One rabbit (R1) was infected with the louse strain of A. baumannii, the second rabbit (R2) with A. baumannii (CIP 53.79), and the third rabbit (R3) with A. lwoffii strain CIP 64.10T. Each of three series of 200 fifteen-day-old uninfected human body lice (P. h. corporis, strain Orlando)17 were infected by feeding on the previously shaved abdomen of one of the three infected rabbits during the artificial bacteremia. The day of infection was referred to as day 0. Each infected louse group then received a maintenance feeding once a day on one of three other SPF rabbits. Lice infected with the louse strain of A. baumannii were nourished on rabbit R4, those infected with A. baumannii (CIP 53.79) on the rabbit R5, and those infected with A. lwoffii on rabbit R6. Two hundred 15-day-old uninfected lice were used as negative controls and were nourished daily on a fourth SPF rabbit (R7). Each louse group was kept in a separate plastic container at 29°C at a relative humidity of 70–90%,18 and each rabbit was kept in an individual cage. The animal study was approved by the Animal Ethics Committee of the Marseille School of Medicine.

Study of rabbit infection. Two hundred microliters EDTA-blood mixture from each of the three infected rabbits (R1, R2, and R3) were assayed by a polymerase chain reaction (PCR). Blood of the A. baumannii (louse strain)–infected rabbit (R1) was obtained immediately and at 1, 2, 16, 19, 22, 25, and 40 hours post-infection. Blood of the A. baumannii (CIP 53.79)–infected rabbit (R2) was obtained immediately and at 1, 2, 16, 19, 22, 25, 40, 48, 64, and 65 hours post-infection and then weekly. Blood from the A. lwoffii-infected rabbit (R3) was obtained immediately and at 1, 2, 15, 18, and 23 hours post-infection. DNA was extracted using the QIAamp Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The DNA was eluted in 100 µL of AE elution buffer. A PCR was conducted with the recA gene using the recA-specific primers recAF (CACAATGA-CATTGCAAGCAATTG) and recAR (ACCAATTTTCAT-ACGAATCTGG) that amplify a 382-basepair fragment. This cassette was used to detect the DNA of both strains of A. baumannii, but not of A. lwoffii. A second PCR was also conducted using the est gene-derived primers estF (GCATATAGTCGGAAAGAACAAG) and estR (GGAT-AGCCAACATTTGTGCATC) that amplify a 309-basepair fragment. This was used to detect A. lwoffii DNA, but not A. baumannii DNA. A third PCR with ß-globin gene–derived primers19 was also used as a control of the efficiency of DNA extraction and the PCR. The PCRs were conducted in a Peltier model PTC-200 thermal cycler (MJ Research, Watertown, MA). Four drops of blood were collected every week by ear puncture from each of the seven rabbits onto blotting paper (Fisher Scientific, Elancourt, France) and used to detect antibodies by an immunofluorescence assay (IFA), as described elsewhere.20

Study of lice infection. The number and the color of surviving and dead lice were noted daily in each of the four louse groups. The number of dead lice in each infected louse group was compared with that of uninfected lice using the chi-square in Epi-Info version 6.0 software (Centers for Disease Control and Prevention, Atlanta, GA). Four surviving and eventually four dead lice from each group were sampled daily. One of each group was assayed by the PCR, one by the IFA, and one by culture, and the hemolymph of the fourth one was extracted for culture and the IFA. A PCR was performed with the recA (both strains of A. baumannii) or the est (A. lwoffii) genes. A PCR with the 18S ribosomal RNA (rRNA)21–derived primers 18Saidg2 and 18Sbi22 was used as a control for the efficiency of DNA extraction and the PCR. DNA extracted from uninfected lice was used as a negative control, and DNA of Acinetobacter spp. was used as a positive control. For the IFA, each louse was fixed in absolute ethanol at 4°C for 2–3 weeks to increase the fixation efficiency. Ethanol-fixed, 5 µm–thick paraffin-embedded sections were generated for the IFA using 30 µL of an anti-Acinetobacter spp. mouse polyclonal antibody diluted to 1:400 in PBS with 3% (w/v) non-fat dried milk. Uninfected lice sections were used as negative controls. For culture, each louse was surface-decontaminated as described elsewhere2 and crushed in 500 µL of PBS. One hundred microliters were used to inoculate Columbia sheep blood agar (bioMérieux). Bacterial identification was made by the oxidase reaction (Oxoid Ltd., Basingstoke, Hampshire, United Kingdom), microscopic examination after Gram staining (bioMérieux), and with API 20 NE strips (bioMérieux) according to the manufacturer’s instructions. Hemolymph of surviving infected lice was extracted by amputation of one or more legs under an enlarged microscope (Stemi 2000-C; Zeiss, Jena, Germany). Extracted hemolymph was immediately suspended in 100 µL of PBS and 70 µL were used to inoculate blood agar (bioMérieux). The remaining 30 µL were air-dried, methanol-fixed for five minutes, and tested by IFA.

Infection of lice feces. Approximately 0.1 mg of feces collected from each group was sampled three times a day and assayed by IFA, PCR, and culture. For the IFA, lice feces was sampled with a sterile cotton swab moisturized with sterile water. For the PCR and culture, lice feces was sampled with the point of a needle (18 gauge, 1.2 mm; Terumo; Leuven, Belgium). Fecal excretion of Acinetobacter spp. was first assessed by an IFA using 30 µL of the anti-Acinetobacter spp. mouse polyclonal antibody diluted to 1:400. The IFA conducted on uninfected lice feces was used as a negative control. To detect Acinetobacter DNA from lice feces in the presence of PCR inhibitors,17 DNA was extracted using the high pure PCR template preparation kit (Roche Diagnostics GmbH, Mannheim, Germany), which contained an inhibitor blocker, as described elsewhere.23 In addition, 2 µL of bovine serum albumin (20 mg/mL) (Roche Diagnostics GmbH) was added to each PCR mixture to improve the PCR amplification. For culture, each sample was suspended in 500µL of PBS and 100 µL were streaked onto agar plates and incubated at 37°C. Bacterial identification was performed as described earlier in this report.

Infection of lice progeny. The number of eggs produced by each louse group was recorded daily. Fisher’s exact test (Epi-Info version 6.0 software; Centers for Disease Control and Prevention) was used to compare the fertility of each of the four louse groups. Two eggs (starting from the laying of the first egg) and two larvae (starting from the hatching of the first egg) were sampled daily: one of each for PCR amplifications and the other for culture. The 18S rRNA PCR was used to control the efficiency of DNA extraction and the PCR. The recA-PCR was used to detect A. baumannii and the est-PCR was used to detect A. lwoffii. Before culture, each egg and larva was decontaminated as previously described.2


RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effect of infection on rabbits. The A. lwoffii-infected rabbit (R3) died on the first day post-infection, and rabbit R1, infected with the louse strain of A. baumannii, died on the second day post-infection. Only the rabbit infected with A. baumannii (CIP 53.79) (R2) remained asymptomatic throughout the experiment, although it developed an antibody response (IgG + IgM) to A. baumannii with a titer of 1:100 on the 7th and 14th days post-infection that increased to 1:200 on the 21st day post-infection and to 1:800 on the 28th and the 35th days post-infection. The ß globin gene PCR always showed positive results with the 30 blood samples from the 3 infected rabbits (8 from R1, 16 from R2, and 6 from R3). This showed the efficiency of DNA extraction and the PCR. The A. baumannii (louse strain)–infected rabbit (R1) remained bacteremic until 40 days post-infection. Rabbit R2, which was infected with A. baumannii (CIP 53.79), remained bacteremic until 48 dasy post-infection, and the A. lwoffii (R3)–infected rabbit remained bacteremic until 23 days post-infection. The four nurse rabbits used to feed infected (R4, R5, and R6) and uninfected (R7) lice remained asymptomatic and seronegative throughout the experiment.

Effect of the infection on lice. Compared with the mean survival of uninfected lice (40 days), the survival of lice infected with A. baumannii (CIP 53.79) (38 days; P = 0.48) and A. lwoffii (40 days; P = 0.18) was not significantly different (Figure 1Go). Only the survival of lice infected with the louse strain of A. baumannii (20 days) was significantly shorter than that of uninfected lice (odds ratio = {infty}, P < 10–2). Interestingly, A. baumannii louse strain–infected lice showed a high mortality only on the second and third days post-infection with 33 (16.5%) lice dying on the second day post-infection and 47 (23.5%) lice dying on the third day post-infection. During these two days, only two lice infected with A. baumannii (CIP 53.79) died, but none of the uninfected and A. lwoffii-infected lice died (Figure 1Go). During the first two days post-infection and starting from the fourth day post-infection until the death of the last infected louse, the mortality rate was low in all four louse groups (Figure 1Go). Throughout the experiment, all surviving and dead lice in the four louse groups were physically indistinguishable.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		    FIGURE 1. Survival rates over time of lice infected with Acinetobacter baumannii UR 10.72 ({diamondsuit}), strain CIP 53.79 ({blacksquare}), and A. lwoffii strain CIP 64.10T (•), and an uninfected control lice ({blacktriangleup}). Day 0 is the day of infection. Values are given as percentages of mean numbers of lice tested.

 
Infection of lice. The results of the 18S rRNA PCR done with 36 lice infected with the louse strain of A. baumannii (19 surviving and 17 dead), 60 lice infected with A. baumannii (CIP 53.79) (36 surviving and 24 dead), and 59 lice infected with A. lwoffii (39 surviving and 20 dead) were always positive, showing the efficiency of DNA extraction and the PCR. The results of the recA PCR were always positive for the 36 lice infected with the louse strain of A. baumannii and the 60 lice infected with A. baumannii (CIP 53.79). The results of the est PCR performed on 59 lice infected with A. lwoffii were always positive. The results of the recA and est PCRs for 53 uninfected lice (39 surviving and 14 dead) was always negative, but the results of the 18S rRNA PCR were always positive. The IFA (Figure 2Go) showed that the three Acinetobacter spp. exhibited similar localization within infected lice (surviving and dead), which demonstrated a diffuse infection. Uninfected lice always showed a negative result in the IFA. All cultures performed on 94 surviving infected lice (19 infected with the louse strain of A. baumannii, 36 with A. baumannii [CIP 53.79], and 39 with A. lwoffii) and on 55 dead infected lice (16 infected with the louse strain of A. baumannii, 22 with A. baumannii [CIP 53.79], and 17 with A. lwoffii) were always positive on the first day following inoculation. Only one colonial morphology, corresponding to Acinetobacter spp., was observed. The results of the cultures and IFA were always negative on the hemolymph extracted individually from 94 surviving infected lice (19 infected with the louse strain of A. baumannii, 36 with A. baumannii [CIP 53.79], and 37 with A. lwoffii) and 52 dead infected lice (16 infected with the louse strain of A. baumannii, 20 with A. baumannii [CIP 53.79], and 16 with A. lwoffii).


Figure 2
View larger version (77K):
[in this window]
[in a new window]

  		    FIGURE 2. Detection of the louse strain of Acinetobacter baumannii by confocal microscopy in a 5 µm–thick section of an infected louse sampled on the second day postinfection (immunofluorescence stained, original magnification x 600). A high level of infection with A. baumannii is apparent throughout louse. Because of the louse dimensions, several photographs were taken and the body was reconstituted digitally. This figure appears in color at www.ajtmh.org.

 
Infection of lice feces. Throughout the experiment, the 58 feces samples excreted by A. baumannii-infected lice with either strain (20 of A. baumannii [louse strain]–infected group and 38 of those infected with A. baumannii [CIP 53.79]) were always positive by the IFA (Figure 3AGo). The results of the IFA done with feces of A. lwoffii-infected lice was always negative during the first 11 days post-infection. However, starting from the 12th day post-infection until the death of the last infected louse on the 40th day post-infection, the results of the fecal IFA were consistently positive. Uninfected lice feces always showed negative results in the IFA. The PCR (Figure 3BGo) used for detection of DNA of the Acinetobacter spp. in excreted feces exhibited the same kinetics reported for the IFA. The results of the recA PCR (detection of DNA of both A. baumannii strains) were consistently positive, and the results of the est PCR (detection of A. lwoffii DNA) were negative between day 0 and the 11th day post-infection, but remained positive between the 12th and 40th days post-infection. The same results were obtained by fecal culture. Cultures were positive one day following inoculation and only one colonial morphology was observed.


Figure 3
View larger version (53K):
[in this window]
[in a new window]

  		    FIGURE 3. Detection of the louse strain of Acinetobacter baumannii in the feces of infected lice by an immunofluorescence assay (IFA) and confocal microscopy (A) and by amplification of the recA gene with a polymerase chain reaction (B). A, The IFA was performed on lice feces excreted on the eighth day postinfection (immunofluorescence stained, original magnification x 630). B, For each day post-infection (from the first to the eleventh day), undiluted and diluted DNAs were assessed.

 
Infection of lice progeny. Lice of all four experimental groups began laying eggs on the fourth day post-infection that hatched 10 days later. The total number of eggs laid during the lifespan of surviving infected lice was 3,639 eggs by A. baumannii (louse strain)–infected lice, 6,212 eggs by those infected with A. baumannii (CIP 53.79), 6,391 eggs by A. lwoffii-infected lice, and 6,392 eggs laid by uninfected lice. The results of the PCR were consistently negative for the recA gene (17 eggs and 6 larvae from the A. baumannii [louse strain]–infected group, 35 eggs and 24 larvae from the A. baumannii [CIP 53.79]–infected group, and 37 eggs and 26 larvae from the uninfected group) and the est gene (37 eggs and 26 larvae from the A. lwoffii-infected group and 37 eggs and 26 larvae from the uninfected group). These samples were always positive by the 18S rRNA PCR, which showed the efficiency of DNA extraction and the PCR. All cultures of these samples were negative.


DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our results demonstrate that the human body louse is able to acquire and maintain a persistent life-long infection with A. baumannii (both strains) and A. lwoffii. Until now, it was recognized that lice not infected with R. prowazekii, Borrelia recurrentis, or Bartonella quintana, as in our rearing, maintain a sterile midgut since lice feed only on sterile host blood.1 The infection of the human body louse with each of these three bacteria is mainly due to the fact that they induce relapsing bacteremia, rather than to a specific adaptation to the body louse.1 In addition to the isolation of A. baumannii from the body lice of homeless patients,2 La Scola and Raoult found that 21% of body lice collected worldwide were naturally infected with A. baumannii.3 However, it is still unknown how all these body lice acquire their infections with A. baumannii. This infection can occur mainly after the ingestion of an infective blood meal from patients with ongoing bacteremia,2,3 or possibly by passage through the human skin while feeding.6 However, La Scola and Raoult reported that no common skin commensal agent has been isolated from body lice.3 In this study, the laboratory-induced infection of the body louse with Acinetobacter spp. occurred as a generalized septicemia throughout the infected louse (Figure 2Go). However, the hemolymph was found not to be infected. This discrepancy may be explained by the occurrence of a transitional passage, which we could not detect, of Acinetobacter spp. into the hemolymph following the burst of the most heavily infected cells, which resulted in the infection of all louse tissues. Only the louse strain of A. baumannii was pathogenic for body lice, which died 20 days earlier than the uninfected lice (P < 10–2) (Figure 1Go). An increased mortality rate was observed between the second and third days post-infection, which could be explained by the intensive multiplication of the bacteria. However, we could not explain why 60% of the lice infected with the louse strain of A. baumannii had an infection for the remainder of their lifespan following the third day post-infection, or the difference in the behavior of the two strains of A. baumannii in the body louse, since the second strain was not pathogenic (P = 0.48). La Scola and Raoult have reported nucleotide variations in the recA gene and a difference in the ampicillin susceptibility among A. baumannii strains.3 Currently, only R. prowazekii is known to be pathogenic for the body louse, which develops a bright red color a few hours before death due to the spread of the ingested blood meal into the hemolymph following the rupture of infected cells and subsequent to the strict intracellular multiplication of R. prowazekii.1,17,24 However, in our experiment, Acinetobacter spp.–infected lice did not exhibit this red color.

Infected body lice began the fecal excretion of both strains of A. baumannii on the first day post-infection and of A. lwoffii on the 11th day post-infection. Moreover, Acinetobacter spp. excreted within feces were viable. In addition, A. baumannii25 and A. lwoffii26 have been reported to have the ability to survive for a long time on dry surfaces. Louse feces containing living bacteria are recognized to constitute a major source of infection to humans, in addition to contamination of their crushed bodies.1,27,28 Thus, the infected feces could transmit the Acinetobacter infection to the host (humans) either by contamination of the bite wound site, when scratched into the skin or via an aerosol. Until they died, the infected lice fed regularly, mated, and continued to produce and deposit eggs on the fourth day post-infection, which hatched 10 days later. Since eggs and larvae were not infected, we conclude that transovarial transmission does not occur in lice, as with the three louse-transmitted bacteria.1,17 This shows that Acinetobacter spp. is only acquired by lice through feeding on host (rabbit) and that its presence presupposes a bacteremia in the host.

The number of bacteria given in our study to the rabbit host (4.5–5.26 x 103 CFU/mL of rabbit blood) was comparable to levels described during human infections with Acinetobacter species. It has been reported that the bacterial count in patients with ventilator-associated pneumonia due to Acinetobacter species was 103 CFU/mL.29 Moreover, an inoculum of 5 x 106 CFU of A. baumannii has been used in an experimental mouse model of acute A. baumannii pneumonia, which reproduced the human disease.30 Since all nurse rabbits used in our experiments to feed the infected lice remained asymptomatic and seronegative, we conclude that the body louse does not transmit its Acinetobacter infection while feeding on the host, as with the three louse-transmitted bacteria.1 The rabbit was shown to be susceptible to the louse strain of A. baumannii and A. lwoffii, but not to A. baumannii (CIP 53.79). In humans, the causes of death due to the infection with A. baumannii have been reported to be related to septic shock,31 bacteremia32 mainly due to its high multiresistance,33 and fimbriae.34 Hemolysins,35 lipopolysaccharides,36 and glucose37 might contribute to the pathogenic properties of Acinetobacter species.

Arthropods (mainly flies) have been reported to play a significant role in the epidemiology of hospital infections,38 and Acinetobacter spp. have been demonstrated to be required for the complete development of Stomoxys calcitrans fly larvae.39 Moreover, isolation of several species of Acinetobacter, but not A. baumannii, has been reported from ticks and fleas,40 A. lwoffii from the Lutzomyia longipalpis sand flies,41 and A. calcoaceticus from numerous arthropods collected from health care facilities (flies, German cockroaches, non-biting midges, beetles, mosquitoes, Tenebrionid beetles, wasps, ants, spiders, and moths).42

In conclusion, we demonstrated that one infected blood meal was sufficient to establish a persistent, life-long infection in the body louse. Acinetobacter baumannii readily infected, multiplied, and proliferated in body lice, producing a generalized infection. The louse strain of A. baumannii was pathogenic for the body louse. Moreover, infected body lice excreted living A. baumannii within their feces, and did not transmit their infection to their nurse host during feeding or transovarially.

Received July 13, 2004. Accepted for publication November 19, 2004.

Acknowledgment: We thank Dr. Patrick Rozmajzl for reviewing the manuscript.

Financial support: This work was supported by an Algerian (Q040031)-French (20005831) grant.

Disclosure: None of the authors has a conflict of interest.

* Address correspondence to Didier Raoult, Unité des Rickettsies, Institut Fédératit de Recherche 48, Centre National de Recherche Scientifique, Unité Mixte de Recherche 6020, Faculté de Médecine, Université de la Méditerranée, 27 Boulevard Jean Moulin 13385 Marseille Cedex 5, France. E-mail: Didier.Raoult{at}medecine.univ-mrs.fr Back

Authors’ address: Linda Houhamdi and Didier Raoult, Unité des Rickettsies, Institut Fédératif de Recherche 48, Centre National de Recherche Scientifique, Unité Mixte de Recherche 6020, Faculté de Médecine, Université de la Méditerranée, 27 Boulevard Jean Moulin 13385 Marseille cedex 5, France, Telephone: 33-491-38-55-17, Fax: 33-491-38-77-72, E-mail: Didier.Raoult{at}medecine.univ-mrs.fr.


REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Raoult D, Roux V, 1999. The body louse as a vector of reemerging human diseases. Clin Infect Dis 29: 888–911.[ISI][Medline]
  2. La Scola B, Fournier PE, Brouqui P, Raoult D, 2001. Detection and culture of Bartonella quintana, Serratia marcescens and Acinetobacter spp. from decontaminated human body lice. J Clin Microbiol 39: 1707–1709.[Abstract/Free Full Text]
  3. La Scola B, Raoult D, 2004. Acinetobacter baumannii in human body louse. Emerg Infect Dis 10: 1671–1673.[ISI][Medline]
  4. Seifert H, 1995. Acinetobacter species as a cause of catheter-related infections. Zentralbl Bakteriol 283: 161–168.[ISI][Medline]
  5. Berlau J, Aucken HM, Houang E, Pitt TL, 1999. Isolation of Acinetobacter spp. including A. baumannii from vegetables: implications for hospital-acquired infections. J Hosp Infect 42: 201–204.[ISI][Medline]
  6. Berlau J, Aucken H, Malnick H, Pitt T, 1999. Distribution of Acinetobacter species on skin of healthy humans. Eur J Clin Microbiol Infect Dis 18: 179–183.[ISI][Medline]
  7. Cisneros JM, Rodriguez-Bano J, 2002. Nosocomial bacteremia due to Acinetobacter baumannii: epidemiology, clinical features and treatment. Clin Microbiol Infect 8: 687–693.[ISI][Medline]
  8. Joly-Guillou ML, 1998. Bacteria of the Acinetobacter genus. Pathol Biol (Paris) 46: 245–252.[Medline]
  9. Boukadida J, 2000. Ecological aspects and prophylaxis of Acinetobacter baumannii nosocomial infection. Tunis Med 78: 480–483.[Medline]
  10. Chiang WC, Su CP, Hsu CY, Chen SY, Chen YC, Chang SC, Hsueh PR, 2003. Community-acquired bacteremic cellulitis caused by Acinetobacter baumannii. J Formos Med Assoc 102: 650–652.[ISI][Medline]
  11. Okpara AU, Maswoswe JJ, 1994. Emergence of multidrug-resistant isolates of Acinetobacter baumannii. Am J Hosp Pharm 51: 2671–2675.[Abstract]
  12. Chen MZ, Hsueh PR, Lee LN, Yu CJ, Yang PC, Luh KT, 2001. Severe community-acquired pneumonia due to Acinetobacter baumannii. Chest 120: 1072–1077.[Abstract/Free Full Text]
  13. Yang CH, Chen KJ, Wang CK, 1997. Community-acquired Acinetobacter pneumonia: a case report. J Infect 35: 316–318.[ISI][Medline]
  14. Chang WN, Lu CH, Huang CR, Chuang YC, 2000. Community-acquired Acinetobacter meningitis in adults. Infection 28: 395–397.[ISI][Medline]
  15. Fournier PE, Ndihokubwayo JB, Guidran J, Kelly PJ, Raoult D, 2002. Human pathogens in body and head lice. Emerg Infect Dis 8: 1515–1518.[ISI][Medline]
  16. Fournier PE, Minnick MF, Lepidi H, Salvo E, Raoult D, 2001. Experimental model of human body louse infection using green fluorescent protein-expressing Bartonella quintana. Infect Immun 69: 1876–1879.[Abstract/Free Full Text]
  17. Houhamdi L, Fournier PE, Fang R, Lepidi H, Raoult D, 2002. An experimental model of human body louse infection with Rickettsia prowazekii. J Infect Dis 186: 1639–1646.[ISI][Medline]
  18. Maunder JW, 1983. The appreciation of lice. Proc R Inst Great Britain 55: 1–31.
  19. Greer CE, Peterson SL, Kiviat NB, Manos MM, 1991. PCR amplification from paraffin-embedded tissues. Effects of fixative and fixation time. Am J Clin Pathol 95: 117–124.[ISI][Medline]
  20. Fenollar F, Raoult D, 1999. Diagnosis of rickettsial diseases using samples dried on blotting paper. Clin Diagn Lab Immunol 6: 483–488.[Medline]
  21. Zhu Y, Fournier PE, Rydkina E, Raoult D, 2003. The geographical segregation of human lice preceded that of Pediculus humanus capitis and Pediculus humanus humanus. C R Biol 326: 565–574.[ISI][Medline]
  22. DeSalle R, Gatesy J, Wheeler W, Grimaldi D, 1992. DNA sequences from a fossil termite in Oligo-Miocene amber and their phylogenetic implications. Science 257: 1933–1936.[Abstract/Free Full Text]
  23. Menotti J, Cassinat B, Porcher R, Sarfati C, Derouin F, Molina JM, 2003. Development of a real-time polymerase-chain-reaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocompromised patients with intestinal microsporidiosis. J Infect Dis 187: 1469–1474.[ISI][Medline]
  24. Wolbach SB, Todd JL, Palfrey FW, 1922. Rickettsia prowazeki in lice. Wolbach S, Todd J, Palfrey F, eds. The Etiology and Pathology of Typhus. Cambridge, MA: Harvard University Press, 132–142.
  25. Jawad A, Seifert H, Snelling AM, Heritage J, Hawkey PM, 1998. Survival of Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates. J Clin Microbiol 36: 1938–1941.[Abstract/Free Full Text]
  26. Rathinavelu S, Zavros Y, Merchant JL, 2003. Acinetobacter lwoffii infection and gastritis. Microbes Infect 5: 651–657.[ISI][Medline]
  27. Nicolle C, Comte C, Conseil E, 1999. Transmission expérimentale du typhus exanthématique par le pou du corps. Acad Sci (Paris) 146: 486–489.
  28. Ito S, Vinson JW, 1965. Fine structure of Rickettsia quintana cultivated in vitro and in the louse. J Bacteriol 89: 481–495.[Abstract/Free Full Text]
  29. Uete T, Matsuo K, 1984. Clinical laboratory approach for estimating effective administration of dosage of cefmenoxime. Observation on the MICS and cefmenoxime disc susceptibility test. Jpn J Antibiot 37: 791–801.[Medline]
  30. Joly-Guillou ML, Wolff M, Pocidalo JJ, Walker F, Carbon C, 1997. Use of a new mouse model of Acinetobacter baumannii pneumonia to evaluate the postantibiotic effect of imipenem. Antimicrob Agents Chemother 41: 345–351.[Abstract]
  31. Jang TN, Kuo BI, Shen SH, Fung CP, Lee SH, Yang TL, Huang CS, 1999. Nosocomial gram-negative bacteremia in critically ill patients: epidemiologic characteristics and prognostic factors in 147 episodes. J Formos Med Assoc 98: 465–473.[ISI][Medline]
  32. Cisneros JM, Reyes MJ, Pachon J, Becerril B, Caballero FJ, Garcia-Garmendia JL, Ortiz C, Cobacho AR, 1996. Bacteremia due to Acinetobacter baumannii: epidemiology, clinical findings, and prognostic features. Clin Infect Dis 22: 1026–1032.[ISI][Medline]
  33. Lai SW, Ng KC, Yu WL, Liu CS, Lai MM, Lin CC, 1999. Acinetobacter baumannii bloodstream infection: clinical features and antimicrobial susceptibilities of isolates. Kaohsiung J Med Sci 15: 406–413.[Medline]
  34. Gospodarek E, Grzanka A, Dudziak Z, Domaniewski J, 1998. Electron-microscopic observation of adherence of Acinetobacter baumannii to red blood cells. Acta Microbiol Pol 47: 213–217.[Medline]
  35. Fleischer M, Przondo-Mordarska A, 1993. Hemolytic properties of bacteria from the genus Acinetobacter. Med Dosw Mikrobiol 45: 311–315.[Medline]
  36. Garcia A, Salgado F, Solar H, Gonzalez CL, Zemelman R, Onate A, 1999. Some immunological properties of lipopolysaccharide from Acinetobacter baumannii. J Med Microbiol 48: 479–483.[ISI][Medline]
  37. Siau H, Yuen KY, Ho PL, Wong SS, Woo PC, 1999. Acinetobacter bacteremia in Hong Kong: prospective study and review. Clin Infect Dis 28: 26–30.[ISI][Medline]
  38. Daniel M, Sramova H, Absolonova V, Dedicova D, Lhotova H, Maskova L, Petras P, 1992. Arthropods in a hospital and their potential significance in the epidemiology of hospital infections. Folia Parasitol (Praha) 39: 159–170.[Medline]
  39. Lysyk TJ, Kalischuk-Tymensen L, Selinger LB, Lancaster RC, Wever L, Cheng KJ, 1999. Rearing stable fly larvae (Diptera: Muscidae) on an egg yolk medium. J Med Entomol 36: 382–388.[ISI][Medline]
  40. Murrell A, Dobsen SJ, Yang X, Lacey E, Barker SC, 2003. A survey of bacterial diversity in ticks, lice and fleas from Australia. Parasitol Res 89: 326–334.[ISI][Medline]
  41. Oliveira SM, Moraes BA, Goncalves CA, Giordano-Dias CM, D’Almeida JM, Asensi MD, Mello RP, Brazil RP, 2000. Rev Soc Bras Med Trop 33: 319–322.[Medline]
  42. Sramova H, Daniel M, Absolonova V, Dedicova D, Jedlickova Z, Lhotova H, Petras P, Subertova V, 1992. Epidemiological role of arthropods detectable in health facilities. J Hosp Infect 20: 281–292.[ISI][Medline]



This article has been cited by other articles:


Home page
 Am J Trop Med HygHome page
L. HOUHAMDI and D. RAOULT
EXPERIMENTALLY INFECTED HUMAN BODY LICE (PEDICULUS HUMANUS HUMANUS) AS VECTORS OF RICKETTSIA RICKETTSII AND RICKETTSIA CONORII IN A RABBIT MODEL
Am J Trop Med Hyg, April 1, 2006; 74(4): 521 - 525.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by HOUHAMDI, L.
Right arrow Articles by RAOULT, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by HOUHAMDI, L.
Right arrow Articles by RAOULT, D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS